Jump to content

Дерево.JPG


Boris Suvorov

Гаплогруппа и гаплотип – как их определяют?

На сегодня известно 20 основных мужских линий человечества, которые называют Y-гаплогруппами и для удобства обозначают латинскими буквами от A до T.

Эти 20 родов в свою очередь разветвляются на более мелкие подветви – субклады, обозначаемые цифрами и буквами – SNP (single nucleotide polymorphism, однонуклеотидный полиморфизм, «снип»).

Древо основных Y-гаплогрупп человечества

Например, человек гаплогруппы R является носителем снипа M207, а также всех иерархически вышележащих «предковых» снипов – M45, L405, M526, M9 и так далее по восходящей вплоть до Адама. Мужчины, имеющие общие снипы имеют общих предков.

Но носителей общих снипов – миллионы, предки которых жили много тысяч лет назад! Как же выделить среди них какую-то отдельную группу близких родственников? Чтобы ответить на этот вопрос нужно протестировать Y-гаплотип.

Y-гаплотип представляет собой совокупность маркёров, которая позволяет найти людей, которые являются друг другу близкими родственниками. Всего на игрек-хромосоме известно свыше 700 маркёров, но для исследований обычно используют только их часть.

Рассмотрим гаплотип, включающий в себя 18 маркёров хромосомы:

Маркёр

393

390

19

391

385a

385b

439

389-I

392

389 II

447

437

448

449

456

576

438

635

Значение

13

24

15

11

11

14

10

13

11

30

24

14

20

32

16

17

11

24

Наименование маркёра говорит о его координате в игрек-хромосоме и повторяющегося фрагмента (мотива) цепочки азотистых оснований. В каждом маркёре расположены аллели, состоящие из тандемных повторов – повторяющихся комбинаций четырёх азотистых оснований (тетрануклеотид) – аденина (A), гуанина (G), цитозина (C), тимина (T).

Например, маркёр DYS393 располагается в позиции 3131152 прямой последовательности игрек-хромосомы (версия GRCh37/hg19). Его тетрануклеотид – AGAT (аденин-гуанин-аденин-тимин). В нашем примере DYS393=13. Это значит, что его повторяющийся мотив включает 13 тандемных повторов и выглядит следующим образом:

AGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGAT.

Различие между мужчинами может быть только в числе повторов. По современным данным, в локусе DYS393 наблюдается от 9 до 17 повторов (в нашем примере – 13).

Если у двух мужчин Y-гаплотипы совпадают, то это означает, что они родственники и происходят от одного предка.

Если совпадают 18 маркёров, то их предок жил от 1 до 250 поколений назад. Иначе говоря, это может быть как родной брат (или сын), так и человек, ближайший общий предок с которым жил более 6 тыс. лет назад. Как видим, диапазон очень широкий и лежит вне пределов непрерывного существования большинства современных народов. Чтобы сократить этот временной размах, нужно протестировать большее число маркёров – скажем, не 18, а 27. И если у двух мужчин совпадают 27 маркёров, то диапазон возраста ближайшего общего составляет уже от 1 до 160 поколений назад, т. е. в пределах последних 4 тыс. лет, что вписывается в рамки возникновения цивилизаций и народов.

Что такое гаплогруппа, гаплотип, субклад, маркеры и снипы.
 Есть всего две «координаты», или системы, в ДНК исследованиях.

 Одна – основана на необратимых мутациях. Это – гаплогруппы, субклады, снипы.

 Другая – на обратимых мутациях. Это – гаплотипы, маркеры, аллели.

Первая система.  Если  к примеру  у вас – гаплогруппа I, ее следующий уровень – гаплогруппа I2, следующий уровень – гаплогруппа I2a, следующий – гаплогруппа I2a1, и так далее, сотни уровней.  Это все – гаплогруппы, но для простоты то, что ниже верхней, гаплогруппы I, называют субкладами. Поэтому I2 – это субклад гаплогруппы I, хотя I2 обычно называют тоже гаплогруппой.  У каждой гаплогруппы есть свой снип, это – необратимая (то есть вечная) мутация, которая гаплогруппу характеризует. Гаплогруппа I – это снип М170, гаплогруппа I2 (она же субклад) – снип М438, он же М170-М438, и так далее. Так можно опускаться до любого уровня, всё более детализируя.

Другая система, связанная с первой – это  гаплотип. Гаплотип – это последовательность маркеров. Если, в вашем гаплотипе – 17 маркеров, то есть 17 фрагментов ДНК (Y-хромосомы). Каждый из них показывается числом, которое показывает, сколько раз этот фрагмент повторяется в ДНК. Каждое число (аллель) в Вашем гаплотипе показывает, сколько раз в маркере повторяется определенный фрагмент. Поскольку 17 маркеров – это немного, то такой же гаплотип встречается и у других, но редко. Если у кого-то еще такой же гаплотип – это может быть или родственник, или случайное совпадение. Если у того, у кого такой же гаплотип, цепь снипов такая же – I-M170 > M438 > P37.2 > M423 > L621 > CTS10936 > CTS10228 > Z17855, то это ваш довольно близкий родственник. Если цепочка другая – это простое совпадение гаплотипов.

Маркеры – участки в ДНК (например, DYS393), им соответствуют числа в гаплотипе.

From the category:

Фотографии пользователей форума

· 48 images
  • 48 images
  • 11 image comments

Photo Information


Recommended Comments

There are no comments to display.

Create an account or sign in to comment

You need to be a member in order to leave a comment

Create an account

Sign up for a new account in our community. It's easy!

Register a new account

Sign in

Already have an account? Sign in here.

Sign In Now
×
×
  • Create New...